POPULATION
A population is the space in which knowledge finds its purpose. It is where individual efforts become collective achievements and where diversity becomes strength.
If the nucleotide, gene, chromosome, and genome represent levels of internal structure, then population is the arena in which that structure is tested in the real world. In this central video, we discuss the Institute’s mission and vision—how molecular genetics and biotechnology are translated into improved health, stronger public systems, food security, environmental protection, and the development of a knowledge-based economy.
Here, it becomes clear why the Institute exists: to transform knowledge into momentum, and momentum into opportunity for society and the future.
CAAATTCAACCCAGTAAACCAAGAATTATCATGATG

