NUCLEOTIDE
A nucleotide is the fundamental unit of every genetic record—small, yet essential. The same is true at our Institute: every researcher is that fundamental point from which a chain of knowledge is built. For forty years, this sequence has continued to grow, generation after generation, each bringing new energy, courage, and pioneering steps into emerging technologies, innovations, and novel approaches.
Science never stands still; it constantly moves beyond the horizon. In the video on this page, we highlight some of those pioneering achievements that have shaped our code of excellence and paved the way for others.
ATCCCCAAGAGTACAATTCCAAGAAATACA

