GENOME
A genome is the complete genetic blueprint of an organism. Likewise, the Institute is a unified entity that brings together research groups, generations, and fields of development within a single strategic framework.
From pioneering DNA sequencing methodologies and the introduction of molecular diagnostics to the establishment of the Centre for Genome Sequencing and Bioinformatics and participation in European consortia, the Institute has grown like a living organism—embracing new technologies and transforming them into lasting institutional strength.
In this video, you will discover who we are today: a team that connects fundamental science with practical application, biomedicine with biotechnology, and innovation with responsibility, building a system that preserves its identity while continually pushing the boundaries of what is possible.
ACGACAATCATTATAACAATG

